LGR5 Human qPCR Primer Pair (NM_003667)
CNY 1,140.00
Cited in 17 publications. |
Product images
CNY 9,960.00
CNY 8,360.00
CNY 7,130.00
Specifications
Product Data | |
Gene ID | 8549 |
Forward Sequence | CCTGCTTGACTTTGAGGAAGACC |
Reverse Sequence | CCAGCCATCAAGCAGGTGTTCA |
Synonyms | FEX; GPR49; GPR67; GRP49; HG38 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (17)
The use of this Gene Expression has been cited in the following citations: |
---|
Chronic Inflammation in Ulcerative Colitis Causes Long-Term Changes in Goblet Cell Function
,null,
Cellular and Molecular Gastroenterology and Hepatology
,PubMed ID 34418586
[LGR5]
|
Lgr5 maintains stemness and regulates cell property in nasopharyngeal carcinoma through Wnt/β-catenin signaling pathway.
,null,
Stem cell research
,PubMed ID 32721896
[LGR5]
|
LGR5+ epithelial tumor stem-like cells generate a 3D-organoid model for ameloblastoma
,null,
Cell Death & Disease
,PubMed ID 32382005
[LGR5]
|
Constitutive STAT5 activation regulates Paneth and Paneth-like cells to control Clostridium difficile colitis
,null,
Life Science Alliance
,PubMed ID 30948494
[LGR5]
|
Engineering a Bioartificial Human Colon Model Through Decellularization and Recellularization.
,null,
Methods in molecular biology (Clifton, N.J.)
,PubMed ID 30542993
[LGR5]
|
Synergistic actions of FGF2 and bone marrow transplantation mitigate radiation-induced intestinal injury
,null,
Cell Death & Disease
,PubMed ID 29515101
[LGR5]
|
Liver damage, proliferation, and progenitor cell markers in experimental necrotizing enterocolitis.
,null,
Journal of pediatric surgery
,PubMed ID 29502797
[LGR5]
|
A recellularized human colon model identifies cancer driver genes
,null,
Nature biotechnology
,PubMed ID 27398792
[LGR5]
|
LGR5 is associated with tumor aggressiveness in papillary thyroid cancer
,null,
Oncotarget
,PubMed ID 26416247
[LGR5]
|
Synthetic, Non-saccharide, Glycosaminoglycan Mimetics Selectively Target Colon Cancer Stem Cells
,null,
ACS Chemical Biology
,PubMed ID 24968014
[LGR5]
|
Transplantation of human fetal biliary tree stem/progenitor cells into two patients with advanced liver cirrhosis
,null,
BMC Gastroenterology
,PubMed ID 25471120
[LGR5]
|
Role of Fn14 in acute alcoholic steatohepatitis in mice
,null,
American Journal of Physiology - Gastrointestinal and Liver Physiology
,PubMed ID 25524063
[LGR5]
|
Inhibition of C-terminal binding protein attenuates transcription factor 4 signaling to selectively target colon cancer stem cells
,null,
Cell Cycle
,PubMed ID 25483087
[LGR5]
|
Resveratrol prevents tumorigenesis in mouse model of Kras activated sporadic colorectal cancer by suppressing oncogenic Kras expression
,null,
Carcinogenesis
,PubMed ID 25280562
[LGR5]
|
TWEAK/Fn14 Signaling Is Required for Liver Regeneration after Partial Hepatectomy in Mice
,null,
PLoS ONE
,PubMed ID 24416188
[LGR5]
|
Identification of a Distinct Small Cell Population from Human Bone Marrow Reveals Its Multipotency In Vivo and In Vitro
,null,
PLoS ONE
,PubMed ID 24465489
[LGR5]
|
PKH26 Staining Defines Distinct Subsets of Normal Human Colon Epithelial Cells at Different Maturation Stages
,null,
PLoS ONE
,PubMed ID 22927961
[LGR5]
|
Documents
FAQs |
Resources
基因表达相关资源 |