Gpx4 Mouse qPCR Primer Pair (NM_001037741)

CAT#: MP205576

qSTAR qPCR primer pairs against Mus musculus gene Gpx4



CN¥ 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (7)
Rabbit polyclonal Glutathione Peroxidase 4 antibody
    • 100 ug

CN¥ 8,025.00


Gpx1 (Myc-DDK-tagged) - Mouse glutathione peroxidase 1 (Gpx1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
    • 10 ug

CN¥ 998.00
CN¥ 2,945.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CN¥ 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CN¥ 2,710.00


Dio1 (Myc-DDK-tagged) - Mouse deiodinase, iodothyronine, type I (Dio1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
    • 10 ug

CN¥ 1,904.00
CN¥ 2,000.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CN¥ 1,330.00


Gpx6 (Myc-DDK-tagged) - Mouse glutathione peroxidase 6 (Gpx6), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
    • 10 ug

CN¥ 2,570.00

Specifications

Product Data
Gene ID 625249
Forward Sequence CCTCTGCTGCAAGAGCCTCCC
Reverse Sequence CTTATCCAGGCAGACCATGTGC
Synonyms GPx-4; GSHPx-4; mtPHG; mtPHGPx; PHG; PHGPx; sn; snGPx
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...