LDHA Human qPCR Primer Pair (NM_005566)
CNY 1,140.00
Cited in 3 publications. |
Product images

CNY 3,600.00
CNY 2,710.00
CNY 2,400.00
CNY 3,990.00
CNY 2,400.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 3939 |
Forward Sequence | GGATCTCCAACATGGCAGCCTT |
Reverse Sequence | AGACGGCTTTCTCCCTCTTGCT |
Synonyms | GSD11; HEL-S-133P; LDHM; PIG19 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Effect of LDHA Inhibition on TNF-α-Induced Cell Migration in Esophageal Cancers
,null,
International Journal of Molecular Sciences
,PubMed ID 36555705
[LDHA]
|
Lactate Dehydrogenase A or B Knockdown Reduces Lactate Production and Inhibits Breast Cancer Cell Motility in vitro
,null,
Frontiers in Pharmacology
,PubMed ID 34744727
[LDHA]
|
Aerobic Glycolysis Controls Myeloid-Derived Suppressor Cells and Tumor Immunity via a Specific CEBPB Isoform in Triple-Negative Breast Cancer
,Li, W;Tanikawa, T;Kryczek, I;Xia, H;Li, G;Wu, K;Wei, S;Zhao, L;Vatan, L;Wen, B;Shu, P;Sun, D;Kleer, C;Wicha, M;Sabel, M;Tao, K;Wang, G;Zou, W;,
Cell Metab.
,PubMed ID 29805099
[LDHA]
|
Documents
FAQs |
Resources
基因表达相关资源 |