GAPDH Human Gene Knockout Kit (CRISPR)
CAT#: KN202309BN
GAPDH - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 600.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | GAPDH |
Locus ID | 2597 |
Kit Components |
KN202309G1, GAPDH gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAAGGCTCGTAGACGCGGTT KN202309G2, GAPDH gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCAACGGGTGAGTTCGCGGG KN202309BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001256799, NM_001289745, NM_001289746, NM_002046, NM_001357943, NR_152150 |
Synonyms | G3PD; GAPD; HEL-S-162eP |
Summary | This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN202309 | GAPDH - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN202309LP | GAPDH - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN202309RB | GAPDH - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN402309 | GAPDH - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA101736 | GAPDH CRISPRa kit - CRISPR gene activation of human glyceraldehyde-3-phosphate dehydrogenase |
CNY 12,255.00 |