Granulin (GRN) Human Gene Knockout Kit (CRISPR)

CAT#: KN202139BN

GRN - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CN¥ 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CN¥ 3,710.00


GRN mouse monoclonal antibody, clone OTI3H6
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


GRN (Myc-DDK-tagged)-Human granulin (GRN)
    • 10 ug

CN¥ 4,416.00
CN¥ 4,560.00

Specifications

Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Donor DNA mBFP-Neo
Symbol Granulin
Locus ID 2896
Kit Components

KN202139G1, Granulin gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAAGGCCACCCAGCTCACCA

KN202139G2, Granulin gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGATGGTCAGTTCTGCCCTG

KN202139BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001012479, NM_002087
Synonyms acrogranin; GEP; GEP, GP88, PEPI, PGRN, PCDGF; GP88; granulin; granulin-epithelin; PC cell-derived growth factor; PCDGF; PEPI; PGRN; proepithelin; progranulin
Summary Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...