Granulin (GRN) Human Gene Knockout Kit (CRISPR)
CAT#: KN202139BN
GRN - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CN¥ 12,260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
Donor DNA | mBFP-Neo |
Symbol | Granulin |
Locus ID | 2896 |
Kit Components |
KN202139G1, Granulin gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAAGGCCACCCAGCTCACCA KN202139G2, Granulin gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGATGGTCAGTTCTGCCCTG KN202139BN-D, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001012479, NM_002087 |
Synonyms | acrogranin; GEP; GEP, GP88, PEPI, PGRN, PCDGF; GP88; granulin; granulin-epithelin; PC cell-derived growth factor; PCDGF; PEPI; PGRN; proepithelin; progranulin |
Summary | Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN202139 | GRN - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN202139LP | GRN - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN202139RB | GRN - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN402139 | GRN - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CN¥ 8,680.00 |
|
GA101952 | GRN CRISPRa kit - CRISPR gene activation of human granulin precursor |
CN¥ 12,255.00 |
其它Granulin产品