Human BORIS (CTCFL) activation kit by CRISPRa

CAT#: GA115390

CTCFL CRISPRa kit - CRISPR gene activation of human CCCTC-binding factor like



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-CTCFL Antibody
    • 100 ul

CNY 5,250.00


CTCFL (Myc-DDK-tagged)-Human CCCTC-binding factor (zinc finger protein)-like (CTCFL)
    • 10 ug

CNY 7,400.00


CTCFL Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol CTCFL
Locus ID 140690
Kit Components

GA115390G1, BORIS gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCCTCCCCTAGGTGTCAC

GA115390G2, BORIS gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGGGGGGTGGTGGGTAA

GA115390G3, BORIS gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGGTAGGAGGGCCAAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_001269040, NM_001269041, NM_001269042, NM_001269043, NM_001269044, NM_001269045, NM_001269046, NM_001269047, NM_001269048, NM_001269049, NM_001269050, NM_001269051, NM_001269052, NM_001269054, NM_001269055, NM_080618, NR_072975
Synonyms BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1
Summary CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...