Human WWP2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	WWP2
Locus ID	11060
Kit Components	GA107599G1, WWP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCATCAACCTTATAGAGGC GA107599G2, WWP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGTTTCTGCTCACCGGA GA107599G3, WWP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATAAAAAGGCCTCCTCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001270453, NM_001270454, NM_001270455, NM_007014, NM_199423, NM_199424
Synonyms	AIP2; WWp2-like
Summary	This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.