Human Vimentin (VIM) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	VIM
Locus ID	7431
Kit Components	GA105122G1, Vimentin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCTTTAATGACTTCCACCA GA105122G2, Vimentin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGATCAGTGGTTTTTACCC GA105122G3, Vimentin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATCACGATTGCACCGGGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_003380
Synonyms	CTRCT30; HEL113
Summary	This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.