Human TCF4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TCF4
Locus ID	6925
Kit Components	GA104778G1, TCF4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGAGATAGCATCCTGAAA GA104778G2, TCF4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTCTTCCAGCTTTGCCA GA104778G3, TCF4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGCTGCACAAGTGTTACCA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001083962, NM_001243226, NM_001243227, NM_001243228, NM_001243230, NM_001243231, NM_001243232, NM_001243233, NM_001243234, NM_001243235, NM_001243236, NM_003199, NM_001306207, NM_001306208, NM_001330604, NM_001330605, NM_001348211, NM_001348212, NM_001348213, NM_001348214, NM_001348215, NM_001348216, NM_001348217, NM_001348218, NM_001348219, NM_001348220, NM_001369567, NM_001369571, NM_001369574, NM_001369577, NM_001369579, NM_001369580, NM_001369581, NM_001369585, NM_001369586, NM_001369568, NM_001369569, NM_001369570, NM_001369572, NM_001369573, NM_001369575, NM_001369576, NM_001369578, NM_001369582, NM_001369583, NM_001369584
Synonyms	bHLHb19; E2-2; ITF-2; ITF2; PTHS; SEF-2; SEF2; SEF2-1; SEF2-1A; SEF2-1B; SEF2-1D; TCF-4
Summary	This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.