Human SREBP2 (SREBF2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SREBF2
Locus ID	6721
Kit Components	GA104619G1, SREBP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGAAGCGGTGCGTGGGGTGA GA104619G2, SREBP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAATGCCTGGAGTAGCCGTC GA104619G3, SREBP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACCGCTTCGCTCGCCCAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_004599, NR_103834
Synonyms	bHLHd2; SREBP-2; SREBP2
Summary	This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.