Human MYH10 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MYH10
Locus ID	4628
Kit Components	GA103070G1, MYH10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGCCAAACCCTGTGCGCAT GA103070G2, MYH10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGAGTCCTGACGTCACCCC GA103070G3, MYH10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTGCGACTCACCTGCAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001256012, NM_001256095, NM_005964
Synonyms	NMMHC-IIB; NMMHCB
Summary	This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.