Human MYH10 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MYH10
Locus ID	4628
Kit Components	GA103070G1, MYH10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGCCAAACCCTGTGCGCAT GA103070G2, MYH10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGAGTCCTGACGTCACCCC GA103070G3, MYH10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTGCGACTCACCTGCAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001256012, NM_001256095, NM_005964
Synonyms	NMMHC-IIB; NMMHCB
Summary	This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.