Human MECP2 activation kit by CRISPRa

CAT#: GA102863

MECP2 CRISPRa kit - CRISPR gene activation of human methyl-CpG binding protein 2



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
MECP2 mouse monoclonal antibody,clone OTI2F1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


MECP2 (Myc-DDK-tagged)-Human methyl CpG binding protein 2 (Rett syndrome) (MECP2), transcript variant 1
    • 10 ug

CNY 3,656.00
CNY 3,990.00


MECP2 mouse monoclonal antibody,clone OTI2F1
    • 30 ul

CNY 800.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol MECP2
Locus ID 4204
Kit Components

GA102863G1, MECP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGGATTAATGGACCCTTG

GA102863G2, MECP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGGAAATCTCGCCAATTGA

GA102863G3, MECP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATCACAGCCAATGACGGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_001110792, NM_001316337, NM_004992, NM_001369391, NM_001369394, NM_001369392, NM_001369393
Synonyms AUTSX3; MRX16; MRX79; MRXS13; MRXSL; PPMX; RS; RTS; RTT
Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...