Human HIF-1 alpha (HIF1A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HIF1A
Locus ID	3091
Kit Components	GA102107G1, HIF-1 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGATGCATGTTTGGGACC GA102107G2, HIF-1 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCTCGTCTGTGTTTAG GA102107G3, HIF-1 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGTTCCTCGAGATCCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001243084, NM_001530, NM_181054
Synonyms	bHLHe78; HIF-1-alpha; HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8
Summary	This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.