Human HIF-1 alpha (HIF1A) activation kit by CRISPRa
CAT#: GA102107
HIF1A CRISPRa kit - CRISPR gene activation of human hypoxia inducible factor 1 subunit alpha
CNY 12,255.00
CNY 6,048.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | HIF1A |
Locus ID | 3091 |
Kit Components | GA102107G1, HIF-1 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGATGCATGTTTGGGACC GA102107G2, HIF-1 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCTCGTCTGTGTTTAG GA102107G3, HIF-1 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGTTCCTCGAGATCCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001243084, NM_001530, NM_181054 |
Synonyms | bHLHe78; HIF-1-alpha; HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8 |
Summary | This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN202461 | HIF1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN202461BN | HIF1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN202461LP | HIF1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN202461RB | HIF1A - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN402461 | HIF1A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |