Human HIF-1 alpha (HIF1A) activation kit by CRISPRa

CAT#: GA102107

HIF1A CRISPRa kit - CRISPR gene activation of human hypoxia inducible factor 1 subunit alpha



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
Rabbit Polyclonal HIF-1 alpha Antibody
    • 100 ul

CNY 6,056.00


HIF1A (Myc-DDK-tagged)-Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) (HIF1A), transcript variant 1
    • 10 ug

CNY 6,048.00


HIF1A mouse monoclonal antibody,clone OTI2D5
    • 30 ul

CNY 800.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol HIF1A
Locus ID 3091
Kit Components

GA102107G1, HIF-1 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGATGCATGTTTGGGACC

GA102107G2, HIF-1 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCTCGTCTGTGTTTAG

GA102107G3, HIF-1 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGTTCCTCGAGATCCAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001243084, NM_001530, NM_181054
Synonyms bHLHe78; HIF-1-alpha; HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8
Summary This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...