SARS-CoV-2 ORF10 Gene cDNA Clone (Native Sequence)

CAT#: VC202564

  • TrueORF®

Native cDNA clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255



  View other clones from "SARS-CoV-2" (41)

Need custom modification / cloning service?
Get a free quote

CNY 3,800.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (1)
DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Type Virus Untagged ORF Clone
Vector pUCminusMCS
E. coli Selection Ampicillin
Mammalian Cell Selection None
Sequence Data
>The Viral ORF clone VC202564 represents NCBI reference of YP_009725255 for cloning vector
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTTGTGCAGAATGAATTCT
CGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAG

ACCN NC_045512
ORF Size 219 bp
OTI Annotation This clone was engineered to express the complete ORF. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NC_045512.2, YP_009725255
RefSeq ORF 219 bp
MW 4.4 kDa
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...