Esr1 Mouse qPCR Primer Pair (NM_007956)
CN¥ 1,140.00
Cited in 3 publications. |
Product images

CN¥ 2,710.00
CN¥ 5,990.00
CN¥ 5,990.00
CN¥ 4,940.00
Specifications
Product Data | |
Gene ID | 13982 |
Forward Sequence | TCTGCCAAGGAGACTCGCTACT |
Reverse Sequence | GGTGCATTGGTTTGTAGCTGGAC |
Synonyms | E; ER; ER-; ER-alpha; ERa; ERalpha; ER[; Es; ESR; Estr; Estra; Nr; Nr3a1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Hypoxia‐induced secretion stimulates breast cancer stem cell regulatory signalling pathways
,null,
Molecular Oncology
,PubMed ID 31066211
[Esr1]
|
Targeting estrogen receptor signaling with fulvestrant enhances immune and chemotherapy-mediated cytotoxicity of human lung cancer
,null,
Clinical cancer research : an official journal of the American Association for Cancer Research
,PubMed ID 27267852
[Esr1]
|
High levels of dietary soy decrease mammary tumor latency and increase incidence in MTB-IGFIR transgenic mice
,Watson, KL;Stalker, L;Jones, RA;Moorehead, RA;,
BMC Cancer
,PubMed ID 25655427
[Esr1]
|
Documents
FAQs |
Resources
基因表达相关资源 |