Asap1 Mouse qPCR Primer Pair (NM_010026)

CAT#: MP203619

qSTAR qPCR primer pairs against Mus musculus gene Asap1



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
Rabbit polyclonal ASAP1 phospho Y782 antibody (Phospho-specific)
    • 100 ug

CNY 8,025.00


Asap1 (Myc-DDK-tagged) - Mouse ArfGAP with SH# domain, ankyrin repeat and PH domain1 (Asap1)
    • 10 ug

CNY 7,984.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


Asap1 (myc-DDK-tagged) - Mouse ArfGAP with SH3 domain, ankyrin repeat and PH domain1 (Asap1), transcript variant 4
    • 10 ug

CNY 11,120.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


Asap1 (myc-DDK-tagged) - Mouse ArfGAP with SH3 domain, ankyrin repeat and PH domain1 (Asap1), transcript variant 2
    • 10 ug

CNY 10,830.00


Asap1 (myc-DDK-tagged) - Mouse ArfGAP with SH3 domain, ankyrin repeat and PH domain1 (Asap1), transcript variant 3
    • 10 ug

CNY 11,210.00


Asap1 (myc-DDK-tagged) - Mouse ArfGAP with SH3 domain, ankyrin repeat and PH domain1 (Asap1), transcript variant 5
    • 10 ug

CNY 10,830.00

Specifications

Product Data
Gene ID 13196
Forward Sequence AGAGACGGAAGTGTGCGGTCAA
Reverse Sequence GACTTCTTGTCCTCAGCATTCGG
Synonyms AV239055; Ddef1; DEF-1; mKIAA1249; PAP; s19
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...