Atp6v0a1 Mouse qPCR Primer Pair (NM_016920)

CAT#: MP201085

qSTAR qPCR primer pairs against Mus musculus gene Atp6v0a1



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (8)
Atp6v0a1 (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit A1 (cDNA clone MGC:76459 IMAGE:30101184)
    • 10 ug

CNY 6,096.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


Atp6v0a1 (myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit A1 (Atp6v0a1), transcript variant 2
    • 10 ug

CNY 7,790.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


Atp6v0a1 (myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit A1 (Atp6v0a1), transcript variant 3
    • 10 ug

CNY 8,270.00


Atp6v0a1 (Myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit A1 (Atp6v0a1)
    • 10 ug

CNY 8,360.00


Atp6v0a1 (myc-DDK-tagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit A1 (Atp6v0a1), transcript variant 4
    • 10 ug

CNY 8,360.00

Specifications

Product Data
Gene ID 11975
Forward Sequence CTGTTATCCTCGGCATCATCCAC
Reverse Sequence CAGGTAGCCAAACAACGAGGAC
Synonyms AA959968; ATP6a1; Atp6n1; Atp6n1a; Atpv0a1; Vpp-1; Vpp1
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...