Adam17 Mouse qPCR Primer Pair (NM_009615)
CN¥ 1,140.00
Cited in 4 publications. |
Product images

CN¥ 6,064.00
CN¥ 2,710.00
CN¥ 8,460.00
CN¥ 5,890.00
Specifications
Product Data | |
Gene ID | 11491 |
Forward Sequence | TGTGAGCGGTGACCACGAGAAT |
Reverse Sequence | TTCATCCACCCTGGAGTTGCCA |
Synonyms | CD156b; Tac; Tace |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Downregulation of sperm-associated antigen 5 inhibits melanoma progression by regulating forkhead box protein M1/A disintegrin and metalloproteinase 17/NOTCH1 signaling
,null,
Bioengineered
,PubMed ID 35138218
[Adam17]
|
Functionally confirmed compound heterozygous ADAM17 missense loss-of-function variants cause neonatal inflammatory skin and bowel disease 1
,null,
Scientific Reports
,PubMed ID 33953303
[Adam17]
|
Ambient PM2.5 chronic exposure leads to cognitive decline in mice: From pulmonary to neuronal inflammation.
,null,
Toxicology letters
,PubMed ID 32569800
[Adam17]
|
Mechanism of enhanced MerTK-dependent macrophage efferocytosis by extracellular vesicles
,null,
Arteriosclerosis, thrombosis, and vascular biology
,PubMed ID 31434491
[Adam17]
|
Documents
FAQs |
Resources
基因表达相关资源 |