SARS-CoV-2 (COVID-19) qPCR Primer Pair N protein

Specifications

Product Data
Gene ID	43740575
Forward Sequence	aagctggacttccctatggtg
Reverse Sequence	cgattgcagcattgttagcagg
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability	Store at -20°C.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.