IL32 Human qPCR Primer Pair (NM_004221)

CAT#: HP234642

qSTAR qPCR primer pairs against Homo sapiens gene IL32



CN¥ 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (12)
Rabbit Polyclonal IL-32 Antibody
    • 100 ug

CN¥ 5,808.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 1
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CN¥ 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CN¥ 2,710.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 6
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CN¥ 1,330.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 2
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 7
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 3
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 4
    • 10 ug

CN¥ 1,200.00
CN¥ 3,705.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 8
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 5
    • 10 ug

CN¥ 3,990.00

Specifications

Product Data
Gene ID 9235
Forward Sequence TCAAAGAGGGCTACCTGGAGAC
Reverse Sequence TCTGTTGCCTCGGCACCGTAAT
Synonyms IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...