Dystrophin (DMD) Human qPCR Primer Pair (NM_004006)

CAT#: HP229118

qSTAR qPCR primer pairs against Homo sapiens gene DMD



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (22)
Dystrophin Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71ab
    • 10 ug

CNY 4,632.00
CNY 5,420.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp260-2
    • 10 ug

CNY 18,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp140bc
    • 10 ug

CNY 11,310.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp116
    • 10 ug

CNY 9,790.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp427p2
    • 10 ug

CNY 50,730.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp427p1
    • 10 ug

CNY 52,440.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant D140ab
    • 10 ug

CNY 12,260.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71b
    • 10 ug

CNY 4,728.00
CNY 7,410.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp427m
    • 10 ug

CNY 41,990.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp140
    • 10 ug

CNY 12,260.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71a
    • 10 ug

CNY 4,496.00
CNY 5,320.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp427l
    • 10 ug

CNY 50,730.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp40
    • 10 ug

CNY 3,656.00
CNY 3,990.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71
    • 10 ug

CNY 4,592.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp427c
    • 10 ug

CNY 52,440.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp260-1
    • 10 ug

CNY 18,990.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp140b
    • 10 ug

CNY 8,656.00


DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp140c
    • 10 ug

CNY 11,120.00

Specifications

Product Data
Gene ID 1756
Forward Sequence GCTCAACCATCGATTTGCAGCC
Reverse Sequence TTCAGCCTCCAGTGGTTCAAGC
Synonyms BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; MRX85
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...