Caspase 1 (CASP1) Human qPCR Primer Pair (NM_033292)

CAT#: HP226271

qSTAR qPCR primer pairs against Homo sapiens gene CASP1



CN¥ 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (11)
Mouse Monoclonal Caspase-1 Antibody (14F468)
    • 100 ug

CN¥ 6,056.00


CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant alpha
    • 10 ug

CN¥ 5,488.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CN¥ 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CN¥ 2,710.00


CASP1 (Myc-DDK tagged) - Homo sapiens caspase 1, apoptosis-related cysteine peptidase (CASP1), transcript variant 7
    • 10 ug

CN¥ 3,656.00
CN¥ 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CN¥ 1,330.00


CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant gamma
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00


CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant beta
    • 10 ug

CN¥ 5,488.00


CASP1 (Myc-DDK tagged) - Homo sapiens caspase 1, apoptosis-related cysteine peptidase (CASP1), transcript variant 6
    • 10 ug

CN¥ 3,656.00
CN¥ 3,990.00


CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant epsilon
    • 10 ug

CN¥ 3,990.00


CASP1 (Myc-DDK-tagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant delta
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00

Specifications

Product Data
Gene ID 834
Forward Sequence GCTGAGGTTGACATCACAGGCA
Reverse Sequence TGCTGTCAGAGGTCTTGTGCTC
Synonyms ICE; IL1BC; P45
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...