RUNX2 Human qPCR Primer Pair (NM_004348)
CNY 1,140.00
Cited in 5 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 3,600.00
CNY 6,576.00
CNY 2,710.00
CNY 3,776.00
CNY 5,040.00
CNY 5,856.00
CNY 5,488.00
Specifications
Product Data | |
Gene ID | 860 |
Forward Sequence | CCCAGTATGAGAGTAGGTGTCC |
Reverse Sequence | GGGTAAGACTGGTCATAGGACC |
Synonyms | AML3; CBFA1; CCD; CCD1; OSF-2; OSF2; PEA2aA; PEBP2A1; PEBP2A2; PEBP2aA; PEBP2aA1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (5)
The use of this Gene Expression has been cited in the following citations: |
---|
Osteoinductive PolyHIPE Foams as Injectable Bone Grafts
,Robinson, J;McEnery, M;Pearce, H;Whitely, M;Munoz-Pinto, D;Hahn, M;Li, H;Sears, N;Cosgriff-Hernandez, E;,
Tissue Eng Part A
,PubMed ID 26739120
[RUNX2]
|
Evaluation of the osteoinductive capacity of polydopamine-coated poly (e-caprolactone) diacrylate shape memory foams
,Erndt-Marino, JD;Munoz-Pinto, DJ;,
ACS Biomaterials science and engineering
[RUNX2]
|
MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions
,Zhou, X;Luan, X;Chen, Z;Francis, M;Gopinathan, G;Li, W;Lu, X;Li, S;Wu, C;Diekwisch, TG;,
J. Dent. Res.
,PubMed ID 26518300
[RUNX2]
|
A bioactive “self-fitting” shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;,
Acta biomaterialia July 2014
[RUNX2]
|
A bioactive self-fitting shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;Jimenez-Vergara, AC;Hahn, MS;Grunlan, MA;,
Acta Biomater July 2014
,PubMed ID 25063999
[RUNX2]
|
Documents
FAQs |
Resources
基因表达相关资源 |