TTC39B Human qPCR Primer Pair (NM_152574)

CAT#: HP217810

qSTAR qPCR primer pairs against Homo sapiens gene TTC39B



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
TTC39B Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TTC39B (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 39B (TTC39B), transcript variant 2
    • 10 ug

CNY 4,984.00
CNY 7,220.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2,710.00


TTC39B (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 39B (TTC39B), transcript variant 3
    • 10 ug

CNY 4,904.00
CNY 7,130.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


TTC39B (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 39B (TTC39B), transcript variant 5
    • 10 ug

CNY 3,848.00
CNY 3,990.00


TTC39B (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 39B (TTC39B), transcript variant 4
    • 10 ug

CNY 4,568.00
CNY 7,220.00


TTC39B (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 39B (TTC39B), transcript variant 1
    • 10 ug

CNY 4,584.00
CNY 7,220.00

Specifications

Product Data
Gene ID 158219
Forward Sequence GAAGGAGCATGAGGTCTGCACT
Reverse Sequence GTGAGCCATTTGGAAACTGCTGG
Synonyms C9orf52
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...