BAX Human qPCR Primer Pair (NM_004324)

CAT#: HP207656

qSTAR qPCR primer pairs against Homo sapiens gene BAX



CNY 1,140.00


货期*
5周

规格
    • 200 reactions

Cited in 1 publication.

Product images

经常一起买 (11)
BAX mouse monoclonal antibody,clone OTI2A1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


BAX (Myc-DDK-tagged)-Human BCL2-associated X protein (BAX), transcript variant alpha
    • 10 ug

CNY 3,600.00
CNY 3,705.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4,180.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1,330.00


BAX (myc-DDK-tagged) - Human BCL2-associated X protein (BAX), transcript variant lambda
    • 10 ug

CNY 3,990.00


BAX (Myc-DDK-tagged)-Human BCL2-associated X protein (BAX), transcript variant sigma
    • 10 ug

CNY 3,990.00


BAX (myc-DDK-tagged) - Human BCL2-associated X protein (BAX), transcript variant gamma
    • 10 ug

CNY 3,990.00


BAX (Myc-DDK-tagged)-Human BCL2-associated X protein (BAX), transcript variant beta
    • 10 ug

CNY 2,400.00
CNY 3,990.00


BAX (myc-DDK-tagged) - Human BCL2-associated X protein (BAX), transcript variant zeta
    • 10 ug

CNY 3,990.00


BAX (myc-DDK-tagged) - Human BCL2-associated X protein (BAX), transcript variant 1
    • 10 ug

CNY 2,400.00
CNY 3,990.00


BAX (Myc-DDK-tagged)-Human BCL2-associated X protein (BAX), transcript variant delta
    • 10 ug

CNY 1,200.00
CNY 3,990.00

Specifications

Product Data
Gene ID 581
Forward Sequence TCAGGATGCGTCCACCAAGAAG
Reverse Sequence TGTGTCCACGGCGGCAATCATC
Synonyms BCL2L4
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...