beta Actin (ACTB) Human qPCR Primer Pair (NM_001101)
CN¥ 1,140.00
货期*
5周
规格
Cited in 34 publications. |
Product images

经常一起买 (6)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
CN¥ 2,710.00
Specifications
Product Data | |
Gene ID | 60 |
Forward Sequence | CACCATTGGCAATGAGCGGTTC |
Reverse Sequence | AGGTCTTTGCGGATGTCCACGT |
Synonyms | BRWS1; PS1TP5BP1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (34)
The use of this Gene Expression has been cited in the following citations: |
---|
Effect of LDHA Inhibition on TNF-α-Induced Cell Migration in Esophageal Cancers
,null,
International Journal of Molecular Sciences
,PubMed ID 36555705
[ACTB]
|
Sodium bicarbonate transporter NBCe1 regulates proliferation and viability of human prostate cancer cells LNCaP and PC3
,null,
Oncology Reports
,PubMed ID 34013380
[ACTB]
|
DCAF1 regulates Treg senescence via the ROS axis during immunological aging
,null,
The Journal of Clinical Investigation
,PubMed ID 32730228
[ACTB]
|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[ACTB]
|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[ACTB]
|
Emerging roles of CCM genes during tumorigenesis with potential application as novel biomarkers across major types of cancers
,Abou-Fadel, J;Qu, Y;Gonzalez, EM;Smith, M;Zhang, J;,
Oncol. Rep.
,PubMed ID 32186778
[ACTB]
|
A Comprehensive Analysis of FUT8 Overexpressing Prostate Cancer Cells Reveals the Role of EGFR in Castration Resistance
,Höti, N;Lih, TS;Pan, J;Zhou, Y;Yang, G;Deng, A;Chen, L;Dong, M;Yang, RB;Tu, CF;Haffner, MC;Kay Li, Q;Zhang, H;,
Cancers (Basel) 2020
,PubMed ID 32085441
[ACTB]
|
Alternatively spliced isoforms reveal a novel type of PTB domain in CCM2 protein
,Jiang, X;Padarti, A;Qu, Y;Sheng, S;Abou-Fadel, J;Badr, A;Zhang, J;,
Sci Rep
,PubMed ID 31676827
[ACTB]
|
Tr-KIT/c-KIT ratio in renal cell carcinoma
,Ergün, S;Altay, DU;Güneş, S;Büyükalpelli, R;Karahan, SC;Tomak, L;Abur, Ü;,
Mol. Biol. Rep.
,PubMed ID 31342295
[ACTB]
|
In vitro evolution of enhanced RNA replicons for immunotherapy
,Li, Y;Teague, B;Zhang, Y;Su, Z;Porter, E;Dobosh, B;Wagner, T;Irvine, DJ;Weiss, R;,
Sci Rep
,PubMed ID 31061426
[ACTB]
|
Effects and Mechanism of Nicotinamide Against UVA- and/or UVB-mediated DNA Damages in Normal Melanocytes
,Chhabra, G;Garvey, DR;Singh, CK;Mintie, CA;Ahmad, N;,
Photochem. Photobiol.
,PubMed ID 30102774
[ACTB]
|
Aerobic Glycolysis Controls Myeloid-Derived Suppressor Cells and Tumor Immunity via a Specific CEBPB Isoform in Triple-Negative Breast Cancer
,Li, W;Tanikawa, T;Kryczek, I;Xia, H;Li, G;Wu, K;Wei, S;Zhao, L;Vatan, L;Wen, B;Shu, P;Sun, D;Kleer, C;Wicha, M;Sabel, M;Tao, K;Wang, G;Zou, W;,
Cell Metab.
,PubMed ID 29805099
[ACTB]
|
Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
,null,
Oncotarget
,PubMed ID 29088794
[ACTB]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[ACTB]
|
Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
,Mirandola, L;Pedretti, E;Figueroa, JA;Chiaramonte, R;Colombo, M;Chapman, C;Grizzi, F;Patrinicola, F;Kast, WM;Nguyen, DD;Rahman, RL;Daver, N;Ruvolo, P;Post, SM;Bresalier, RS;Chiriva-Internati, M;,
Oncotarget
[ACTB]
|
Novel functions of CCM1 delimit the relationship of PTB/PH domains
,Zhang, J;Dubey, P;Padarti, A;Zhang, A;Patel, R;Patel, V;Cistola, D;Badr, A;,
Biochim. Biophys. Acta
,PubMed ID 28698152
[ACTB]
|
Differentially expressed proteins underlying childhood cortical dysplasia with epilepsy identified by iTRAQ proteomic profiling
,Qin, L;Liu, X;Liu, S;Liu, Y;Yang, Y;Yang, H;Chen, Y;Chen, L;,
PLoS ONE
,PubMed ID 28222113
[ACTB]
|
Targeted knockdown of polo-like kinase 1 alters metabolic regulation in melanoma
,Gutteridge, RE;Singh, CK;Ndiaye, MA;Ahmad, N;,
Cancer Lett
,PubMed ID 28235541
[ACTB]
|
Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D co-culture model
,Erndt-Marino, J;Hahn, MS;,
J Biomed Mater Res A
,PubMed ID 27860234
[ACTB]
|
The a3 isoform of subunit a of the vacuolar ATPase localizes to the plasma membrane of invasive breast tumor cells and is overexpressed in human breast cancer
,Cotter, K;Liberman, R;Sun-Wada, G;Wada, Y;Sgroi, D;Naber, S;Brown, D;Breton, S;Forgac, M;,
Oncotarget
,PubMed ID 27323815
[ACTB]
|
Serum availability affects expression of common house-keeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies
,Krzystek-Korpacka, M;Hotowy, K;Czapinska, E;Podkowik, M;Bania, J;Gamian, A;Bednarz-Misa, I;,
Cytotechnology
,PubMed ID 27339468
[ACTB]
|
Effect of photodynamic therapy combined with torasemide on the expression of matrix metalloproteinase 2 and sodium-potassium-chloride cotransporter 1 in rat peritumoral edema and glioma
,null,
Oncology Letters
,PubMed ID 26998126
[ACTB]
|
Osteoinductive PolyHIPE Foams as Injectable Bone Grafts
,Robinson, J;McEnery, M;Pearce, H;Whitely, M;Munoz-Pinto, D;Hahn, M;Li, H;Sears, N;Cosgriff-Hernandez, E;,
Tissue Eng Part A
,PubMed ID 26739120
[ACTB]
|
Evaluation of the osteoinductive capacity of polydopamine-coated poly (e-caprolactone) diacrylate shape memory foams
,Erndt-Marino, JD;Munoz-Pinto, DJ;,
ACS Biomaterials science and engineering
[ACTB]
|
Collagen-mimetic hydrogels promote human endothelial cell adhesion, migration and phenotypic maturation
,Munoz-Pinto, DJ;Guiza-Arguello, VR;,
Journal of Materials Chemistry B
[ACTB]
|
Nemo-like kinase expression predicts poor survival in colorectal cancer
,Chen, J;Han, Y;Zhao, X;Yang, M;Liu, B;Xi, X;Xu, X;Liang, T;Xia, L;,
Mol Med Rep
,PubMed ID 25371216
[ACTB]
|
Akt confers cisplatin chemoresistance in human gynecological carcinoma cells by modulating PPM1D stability
,Ali, AY;Kim, JY;Pelletier, JF;Vanderhyden, BC;Bachvarov, DR;Tsang, BK;,
Mol. Carcinog.
,PubMed ID 25154814
[ACTB]
|
Association of reduced XRCC2 expression with lymph node metastasis in breast cancer tissues
,Bashir, N;Sana, S;Mahjabeen, I;Kayani, MA;,
Fam. Cancer
,PubMed ID 25159888
[ACTB]
|
A bioactive “self-fitting” shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;,
Acta biomaterialia July 2014
[ACTB]
|
A bioactive self-fitting shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;Jimenez-Vergara, AC;Hahn, MS;Grunlan, MA;,
Acta Biomater July 2014
,PubMed ID 25063999
[ACTB]
|
Expression Stability of Common Housekeeping Genes Is Differently Affected by Bowel Inflammation and Cancer: Implications for Finding Suitable Normalizers for Inflammatory Bowel Disease Studies
,Krzystek-Korpacka, M;Diakowska, D;Bania, J;Gamian, A;,
Inflamm. Bowel Dis.
,PubMed ID 24859296
[ACTB]
|
The influence of AKT isoforms on radiation sensitivity and DNA repair in colon cancer cell lines
,Sahlberg, SH;Gustafsson, AS;Pendekanti, PN;Glimelius, B;Stenerlöw, B;,
Tumour Biol. Dec 2013.
,PubMed ID 24338765
[ACTB]
|
Using protein microarray technology to screen anti-ERCC1 monoclonal antibodies for specificity and applications in pathology
,null,
BMC Biotechnology
,PubMed ID 23171216
[ACTB]
|
Quantification of SLIT-ROBO transcripts in hepatocellular carcinoma reveals two groups of genes with coordinate expression
,null,
BMC Cancer
,PubMed ID 19114000
[ACTB]
|
Documents
FAQs |
Resources
基因表达相关资源 |
Customer
Reviews
Loading...