SULT1A1 Human qPCR Primer Pair (NM_001055)

CAT#: HP203776

qSTAR qPCR primer pairs against Homo sapiens gene SULT1A1



CN¥ 1,140.00


货期*
5周

规格
    • 200 reactions

Product images

经常一起买 (9)
SULT1A1 mouse monoclonal antibody, clone OTI9B7 (formerly 9B7)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 1
    • 10 ug

CN¥ 3,600.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CN¥ 4,180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CN¥ 2,710.00


SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 4
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CN¥ 1,330.00


SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 3
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00


SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5
    • 10 ug

CN¥ 2,400.00
CN¥ 3,705.00


SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 2
    • 10 ug

CN¥ 2,400.00
CN¥ 3,990.00

Specifications

Product Data
Gene ID 6817
Forward Sequence GGAGTTCATGGACCACAGCATC
Reverse Sequence CCTGCCATCTTCTCCGCATAGT
Synonyms HAST1/HAST2; P-PST; P-PST 1; PST; ST1A1; ST1A3; STP; STP1; ts-PST; TSPST1
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...