EPO Human qPCR Primer Pair (NM_000799)
CN¥ 1,140.00
Cited in 5 publications. |
Product images
CN¥ 2,710.00
CN¥ 1,999.00
CN¥ 2,700.00
Specifications
Product Data | |
Gene ID | 2056 |
Forward Sequence | GCATGTGGATAAAGCCGTCAGTG |
Reverse Sequence | GAGTTTGCGGAAAGTGTCAGCAG |
Synonyms | DBAL; ECYT5; EP; MVCD2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (5)
The use of this Gene Expression has been cited in the following citations: |
---|
A novel germline gain-of-function HIF2A mutation in hepatocellular carcinoma with polycythemia
,null,
Aging (Albany NY)
,PubMed ID 32235007
[EPO]
|
Vorinostat suppresses hypoxia signaling by modulating nuclear translocation of hypoxia inducible factor 1 alpha
,null,
Oncotarget
,PubMed ID 28915577
[EPO]
|
Vorinostat suppresses hypoxia signaling by modulating nuclear translocation of hypoxia inducible factor 1 alpha
,Zhang, C;Yang, C;Feldman, MJ;Wang, H;Pang, Y;Maggio, DM;Zhu, D;Nesvick, CL;Dmitriev, P;Bullova, P;Chittiboina, P;Brady, RO;Pacak, K;Zhuang, Z;,
Oncotarget
,PubMed ID 28611287
[EPO]
|
New Syndrome of Paraganglioma and Somatostatinoma Associated With Polycythemia
,Karel Pacak, Ivana Jochmanova, Tamara Prodanov, Chunzhang Yang, Maria J. Merino, Tito Fojo, Josef T. Prchal, Arthur S. Tischler, Ronald M. Lechan, and Zhengping Zhuang,
J. Clin. Oncol., May 2013; 31: 1690 - 1698.
,PubMed ID 23509317
[EPO]
|
Somatic HIF2α gain-of-function mutations in paraganglioma and somatostatinoma associated with polycythemia
,null,
The New England journal of medicine
,PubMed ID 22931260
[EPO]
|
Documents
FAQs |
Resources
基因表达相关资源 |