p53 (TP53) Human qPCR Primer Pair (NM_000546)
CN¥ 1,140.00
Cited in 22 publications. |
Product images

CN¥ 2,710.00
CN¥ 3,656.00
CN¥ 5,320.00
CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 5,488.00
CN¥ 5,795.00
CN¥ 2,640.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,990.00
Specifications
Product Data | |
Gene ID | 7157 |
Forward Sequence | CCTCAGCATCTTATCCGAGTGG |
Reverse Sequence | TGGATGGTGGTACAGTCAGAGC |
Synonyms | BCC7; BMFS5; LFS1; P53; TRP53 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (22)
The use of this Gene Expression has been cited in the following citations: |
---|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[TP53]
|
Mongolian Medicine RuXian-I Treatment of Estrogen-Induced Mammary Gland Hyperplasia in Rats Related to TCTP Regulating Apoptosis
,null,
Evidence-based Complementary and Alternative Medicine : eCAM
,PubMed ID 31015848
[TP53]
|
Arecoline N-oxide regulates oral squamous cell carcinoma development through NOTCH1 and FAT1 expressions
,Kuo, TM;Nithiyanantham, S;Lee, CP;Hsu, HT;Luo, SY;Lin, YZ;Yeh, KT;Ko, YC;,
J. Cell. Physiol.
,PubMed ID 30624777
[TP53]
|
Length and secondary structure of the 5â² non-coding regions of mouse p53 mRNA transcripts - mouse as a model organism for p53 gene expression studies
,null,
RNA Biology
,PubMed ID 30518296
[TP53]
|
Functional role of RRS1 in breast cancer cell proliferation. Functional role of RRS1 in breast cancer cell proliferation
,null,
Journal of Cellular and Molecular Medicine
,PubMed ID 30320499
[TP53]
|
Isolated Langerhans cell histiocytosis of the stomach: a case report and literature review
,null,
International Journal of Clinical and Experimental Pathology
,PubMed ID 31949684
[TP53]
|
PEPD is a pivotal regulator of p53 tumor suppressor
,null,
Nature Communications
,PubMed ID 29233996
[TP53]
|
The Tumor Suppressor, P53, Decreases the Metal Transporter, ZIP14
,null,
Nutrients
,PubMed ID 29292794
[TP53]
|
Musashi-2, a novel oncoprotein promoting cervical cancer cell growth and invasion, is negatively regulated by p53-induced miR-143 and miR-107 activation
,null,
Journal of Experimental & Clinical Cancer Research : CR
,PubMed ID 29073938
[TP53]
|
iASPP induces EMT and cisplatin resistance in human cervical cancer through miR-20a-FBXL5/BTG3 signaling
,null,
Journal of Experimental & Clinical Cancer Research : CR
,PubMed ID 28399926
[TP53]
|
mir-660-p53-mir-486 Network: A New Key Regulatory Pathway in Lung Tumorigenesis
,null,
International Journal of Molecular Sciences
,PubMed ID 28124991
[TP53]
|
Suppression of iASPP-dependent aggressiveness in cervical cancer through reversal of methylation silencing of microRNA-124
,null,
Scientific Reports
,PubMed ID 27765948
[TP53]
|
Synergy between histone deacetylase inhibitors and DNA-damaging agents is mediated by histone deacetylase 2 in colorectal cancer
,null,
Oncotarget
,PubMed ID 27283986
[TP53]
|
Intravenous leiomyomatosis with intracardiac extension depicted on computed tomography and magnetic resonance imaging scans: A report of two cases and a review of the literature
,null,
Oncology Letters
,PubMed ID 27313775
[TP53]
|
Mitochondrial p53 phosphorylation induces Bak-mediated and caspase-independent cell death
,null,
Oncotarget
,PubMed ID 25980443
[TP53]
|
NORE1A is a Ras senescence effector that controls the apoptotic/senescent balance of p53 via HIPK2
,null,
The Journal of Cell Biology
,PubMed ID 25778922
[TP53]
|
Cytosolic galectin-7 impairs p53 functions and induces chemoresistance in breast cancer cells
,null,
BMC Cancer
,PubMed ID 25367122
[TP53]
|
p53 suppresses stress-induced cellular senescence via regulation of autophagy under the deprivation of serum.
,null,
Molecular medicine reports
,PubMed ID 25369834
[TP53]
|
Expression of Galectin-7 Is Induced in Breast Cancer Cells by Mutant p53
,null,
PLoS ONE
,PubMed ID 23967302
[TP53]
|
Downregulation of SMG-1 in HPV-positive head and neck squamous cell carcinoma due to promoter hypermethylation correlates with improved survival
,null,
Clinical cancer research : an official journal of the American Association for Cancer Research
,PubMed ID 22247495
[TP53]
|
Discovery, In Vivo Activity, and Mechanism of Action of a Small-Molecule p53 Activator
,null,
Cancer Cell
,PubMed ID 18455128
[TP53]
|
Role of SCF Ubiquitin-Ligase and the COP9 Signalosome in the N Gene-Mediated Resistance Response to Tobacco mosaic virus
,null,
The Plant Cell
,PubMed ID 12119369
[TP53]
|
Documents
FAQs |
Resources
基因表达相关资源 |