HPRT (HPRT1) Human qPCR Primer Pair (NM_000194)
CNY 1,140.00
Cited in 6 publications. |
Product images
CNY 3,600.00
CNY 3,705.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 3251 |
Forward Sequence | CATTATGCTGAGGATTTGGAAAGG |
Reverse Sequence | CTTGAGCACACAGAGGGCTACA |
Synonyms | HGPRT; HPRT |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (6)
The use of this Gene Expression has been cited in the following citations: |
---|
A missense mutation in IFT74, encoding for an essential component for intraflagellar transport of Tubulin, causes asthenozoospermia and male infertility without clinical signs of Bardet-Biedl syndrome
,Lor?s, P;Kherraf, ZE;Amiri-Yekta, A;Whitfield, M;Daneshipour, A;Stouvenel, L;Cazin, C;Cavarocchi, E;Coutton, C;Llabador, MA;Arnoult, C;Thierry-Mieg, N;Ferreux, L;Patrat, C;Hosseini, SH;Mustapha, SFB;Zouari, R;Dulioust, E;Ray, PF;Tour?, A;,
Human genetics
,PubMed ID 33689014
[HPRT1]
|
Titanium salts tested in reconstructed human skin with integrated MUTZ-3 derived Langerhans cells show an irritant rather than a sensitizing potential
,Rodrigues Neves, CT;Spiekstra, SW;de Graaf, NPJ;Rustemeyer, T;Feilzer, AJ;Kleverlaan, CJ;Gibbs, S;,
Contact Derm.
,PubMed ID 32677096
[HPRT1]
|
Multi-species oral biofilm promotes reconstructed human gingiva epithelial barrier function
,null,
Scientific Reports
,PubMed ID 30375445
[HPRT1]
|
Endothelial cells enhance adipose mesenchymal stromal cell-mediated matrix contraction via ALK receptors and reduced follistatin: Potential role of endothelial cells in skin fibrosis
,Monsuur, HN;van den Broek, LJ;Koolwijk, P;Niessen, FB;Gibbs, S;,
J. Cell. Physiol.
,PubMed ID 29345319
[HPRT1]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[HPRT1]
|
Increased epidermal thickness and abnormal epidermal differentiation in keloid scars
,Limandjaja, GC;van den Broek, LJ;Waaijman, T;van Veen, HA;Everts, V;Monstrey, S;Scheper, RJ;Niessen, FB;Gibbs, S;,
Br. J. Dermatol.
,PubMed ID 27377288
[HPRT1]
|
Documents
FAQs |
Resources
基因表达相关资源 |