CD36 Human qPCR Primer Pair (NM_000072)
CN¥ 1,140.00
Cited in 4 publications. |
Product images

CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 2,710.00
CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,656.00
CN¥ 3,990.00
CN¥ 3,990.00
CN¥ 3,656.00
CN¥ 3,990.00
Specifications
Product Data | |
Gene ID | 948 |
Forward Sequence | CAGGTCAACCTATTGGTCAAGCC |
Reverse Sequence | GCCTTCTCATCACCAATGGTCC |
Synonyms | BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Rapid generation of purified human RPE from pluripotent stem cells using 2D cultures and lipoprotein uptake-based sorting
,Michelet, F;Balasankar, A;Teo, N;Stanton, LW;Singhal, S;,
Stem Cell Res Ther
,PubMed ID 32014053
[CD36]
|
Inflammatory Cytokine-Mediated Regulation of Thrombospondin-1 and CD36 in Conjunctival Cells
,Soriano-Romaní, L;Contreras-Ruiz, L;García-Posadas, L;López-García, A;Masli, S;Diebold, Y;,
J Ocul Pharmacol Ther
,PubMed ID 26154920
[CD36]
|
Thrombospondin-1 induces differential response in human corneal and conjunctival epithelial cells lines under in vitro inflammatory and apoptotic conditions
,Soriano-Romaní, L;García-Posadas, L;López-García, A;Paraoan, L;Diebold, Y;,
Exp. Eye Res.
,PubMed ID 25753839
[CD36]
|
Selenoprotein K is required for palmitoylation of CD36 in macrophages: implications in foam cell formation and atherogenesis
,null,
Journal of Leukocyte Biology
,PubMed ID 23444136
[CD36]
|
Documents
FAQs |
Resources
基因表达相关资源 |