Mtor Mouse Gene Knockout Kit (CRISPR)

CAT#: KN510503

Mtor - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.




 KN2.0 knockout kit validation

  See Other Versions

CNY 8,680.00

CNY 12,260.00


货期*
2周

规格
    • 1 kit

Product images

经常一起买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Mtor (Myc-DDK-tagged) - Mouse mechanistic target of rapamycin (serine/threonine kinase) (Mtor)
    • 10 ug

CNY 16,824.00

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol Mtor
Locus ID 56717
Kit Components

KN510503G1, Mtor gRNA vector 1 in pCas-Guide CRISPR vector

KN510503G2, Mtor gRNA vector 2 in pCas-Guide CRISPR vector

KN510503D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_020009
Synonyms 2610315D21Rik; AI327068; flat; FRAP; Frap1; FRAP2; RAFT1; RAPT1
Summary Serine/threonine protein kinase which is a central regulator of cellular metabolism, growth and survival in response to hormones, growth factors, nutrients, energy and stress signals (PubMed:15467718, PubMed:15545625, PubMed:16221682, PubMed:16915281, PubMed:16962653, PubMed:18046414, PubMed:19440205, PubMed:21659604). MTOR directly or indirectly regulates the phosphorylation of at least 800 proteins (PubMed:15467718, PubMed:15545625, PubMed:16221682, PubMed:16915281, PubMed:16962653, PubMed:18046414, PubMed:19440205, PubMed:21659604). Functions as part of 2 structurally and functionally distinct signaling complexes mTORC1 and mTORC2 (mTOR complex 1 and 2) (PubMed:15467718, PubMed:16962653, PubMed:21659604). Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis (By similarity). This includes phosphorylation of EIF4EBP1 and release of its inhibition toward the elongation initiation factor 4E (eiF4E) (By similarity). Moreover, phosphorylates and activates RPS6KB1 and RPS6KB2 that promote protein synthesis by modulating the activity of their downstream targets including ribosomal protein S6, eukaryotic translation initiation factor EIF4B, and the inhibitor of translation initiation PDCD4 (By similarity). Stimulates the pyrimidine biosynthesis pathway, both by acute regulation through RPS6KB1-mediated phosphorylation of the biosynthetic enzyme CAD, and delayed regulation, through transcriptional enhancement of the pentose phosphate pathway which produces 5-phosphoribosyl-1-pyrophosphate (PRPP), an allosteric activator of CAD at a later step in synthesis, this function is dependent on the mTORC1 complex (By similarity). Regulates ribosome synthesis by activating RNA polymerase III-dependent transcription through phosphorylation and inhibition of MAF1 an RNA polymerase III-repressor (By similarity). In parallel to protein synthesis, also regulates lipid synthesis through SREBF1/SREBP1 and LPIN1 (PubMed:11792863). To maintain energy homeostasis mTORC1 may also regulate mitochondrial biogenesis through regulation of PPARGC1A (PubMed:18046414). mTORC1 also negatively regulates autophagy through phosphorylation of ULK1 (PubMed:21258367). Under nutrient sufficiency, phosphorylates ULK1 at 'Ser-758', disrupting the interaction with AMPK and preventing activation of ULK1 (PubMed:21258367). Also prevents autophagy through phosphorylation of the autophagy inhibitor DAP (By similarity). Also prevents autophagy by phosphorylating RUBCNL/Pacer under nutrient-rich conditions (By similarity). mTORC1 exerts a feedback control on upstream growth factor signaling that includes phosphorylation and activation of GRB10 a INSR-dependent signaling suppressor (PubMed:21659604). Among other potential targets mTORC1 may phosphorylate CLIP1 and regulate microtubules (By similarity). As part of the mTORC2 complex MTOR may regulate other cellular processes including survival and organization of the cytoskeleton (By similarity). Plays a critical role in the phosphorylation at 'Ser-473' of AKT1, a pro-survival effector of phosphoinositide 3-kinase, facilitating its activation by PDK1 (By similarity). mTORC2 may regulate the actin cytoskeleton, through phosphorylation of PRKCA, PXN and activation of the Rho-type guanine nucleotide exchange factors RHOA and RAC1A or RAC1B (By similarity). mTORC2 also regulates the phosphorylation of SGK1 at 'Ser-422' (By similarity). Regulates osteoclastogenesis by adjusting the expression of CEBPB isoforms (PubMed:19440205). Plays an important regulatory role in the circadian clock function; regulates period length and rhythm amplitude of the suprachiasmatic nucleus (SCN) and liver clocks (PubMed:29750810).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...