Met Mouse Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	Met
Locus ID	17295
Kit Components	KN309983G1, Met gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTTGGTGCAGAGGAGCCATG KN309983G2, Met gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTTCATCTCAGACTTCACTA KN309983-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_008591
Synonyms	AI838057; c-Met; HGF; HGFR; Par4

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.