Cxcr3 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN304051LP

Cxcr3 - mouse gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Cxcr3 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) receptor 3 (Cxcr3)
    • 10 ug

CNY 5,488.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol Cxcr3
Locus ID 12766
Kit Components

KN304051G1, Cxcr3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTATCCGAGCTCGGCCACT

KN304051G2, Cxcr3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGGATACCAGGGACAAGCGT

KN304051LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_009910
Synonyms Cd183; Cmkar3
Summary This gene encodes a transmembrane protein that functions as a receptor for C-X-R chemokines. Signalling through this protein regulates a variety of biological processes, including inflammation, immunity, and would healing. This protein also plays a role in tumor growth and metastasis. [provided by RefSeq, May 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...