Cxcl5 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN304047

Cxcl5 - mouse gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Cxcl5 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 5 (Cxcl5)
    • 10 ug

CNY 1,800.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Cxcl5
Locus ID 20311
Kit Components

KN304047G1, Cxcl5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTTCCATCTCGCCATTCATG

KN304047G2, Cxcl5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTGCCGCAGCATCTAGCTGA

KN304047-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_009141
Synonyms AMCF-II; Cxcl6; ENA-78; GCP-2; LIX; Scyb5; Scyb6
Summary This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils and to have homeostatic and inflammatory functions. In mouse, deficiency of this gene is associated with increased lung inflammation that is neutrophil-dependent. [provided by RefSeq, May 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...