NF-kB p65 (RELA) Human Gene Knockout Kit (CRISPR)

CAT#: KN220780

RELA - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CN¥ 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CN¥ 3,710.00


Rabbit polyclonal RELA Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


RELA (Myc-DDK-tagged)-Human v-rel reticuloendotheliosis viral oncogene homolog A (avian) (RELA), transcript variant 1
    • 10 ug

CN¥ 4,104.00
CN¥ 4,560.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol NF-kB p65
Locus ID 5970
Kit Components

KN220780G1, NF-kB p65 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCGGGGTGGCATCGCCG

KN220780G2, NF-kB p65 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGGCCGCCGCGGCTGTGGC

KN220780-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001145138, NM_001243984, NM_001243985, NM_021975
Synonyms NFKB3; p65
Summary NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...