EMA (MUC1) Human Gene Knockout Kit (CRISPR)
CAT#: KN219922LP
MUC1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CN¥ 12,260.00
CN¥ 3,710.00
CN¥ 1,999.00
CN¥ 2,700.00
CN¥ 2,400.00
CN¥ 3,990.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | EMA |
Locus ID | 4582 |
Kit Components |
KN219922G1, EMA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCTGCTTAGGTGGTCTTCG KN219922G2, EMA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTGCTCCTCACAGTGCTTAC KN219922LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001018016, NM_001018017, NM_001018021, NM_001044390, NM_001044391, NM_001044392, NM_001044393, NM_001204285, NM_001204286, NM_001204287, NM_001204288, NM_001204289, NM_001204290, NM_001204291, NM_001204292, NM_001204293, NM_001204294, NM_001204295, NM_001204296, NM_001204297, NM_002456, NM_182741 |
Synonyms | ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC |
Summary | This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN219922 | MUC1 - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN219922BN | MUC1 - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN219922RB | MUC1 - human gene knockout kit via CRISPR, HDR mediated |
CN¥ 12,260.00 |
|
KN419922 | MUC1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CN¥ 8,680.00 |
|
GA103032 | MUC1 CRISPRa kit - CRISPR gene activation of human mucin 1, cell surface associated |
CN¥ 12,255.00 |