EMA (MUC1) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA	Luciferase-Puro
Symbol	EMA
Locus ID	4582
Kit Components	KN219922G1, EMA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCTGCTTAGGTGGTCTTCG KN219922G2, EMA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTGCTCCTCACAGTGCTTAC KN219922LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_001018016, NM_001018017, NM_001018021, NM_001044390, NM_001044391, NM_001044392, NM_001044393, NM_001204285, NM_001204286, NM_001204287, NM_001204288, NM_001204289, NM_001204290, NM_001204291, NM_001204292, NM_001204293, NM_001204294, NM_001204295, NM_001204296, NM_001204297, NM_002456, NM_182741
Synonyms	ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC
Summary	This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.