SAP155 (SF3B1) Human Gene Knockout Kit (CRISPR)

CAT#: KN219649

SF3B1 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


SF3B1 Rabbit monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


SF3B1 (Myc-DDK-tagged)-Human splicing factor 3b, subunit 1, 155kDa (SF3B1), transcript variant 2
    • 10 ug

CNY 1,800.00
CNY 4,180.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol SAP155
Locus ID 23451
Kit Components

KN219649G1, SAP155 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAGATCGCCAAGACTCACGA

KN219649G2, SAP155 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACGAAGAAAACACGTAAGCA

KN219649-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001005526, NM_001308824, NM_012433
Synonyms Hsh155; MDS; PRP10; PRPF10; SAP155; SF3b155
Summary This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...