PTPRS Human Gene Knockout Kit (CRISPR)
CAT#: KN211163LP
PTPRS - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 10,296.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | PTPRS |
Locus ID | 5802 |
Kit Components |
KN211163G1, PTPRS gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTTGTGGTCCTGCTCGTTGG KN211163G2, PTPRS gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTGTCTGTGGTTGGTCCCAT KN211163LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_002850, NM_130853, NM_130854, NM_130855 |
Synonyms | PTPSIGMA; R-PTP-S; R-PTP-sigma |
Summary | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN211163 | PTPRS - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN211163BN | PTPRS - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN211163RB | PTPRS - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN411163 | PTPRS - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA103946 | PTPRS CRISPRa kit - CRISPR gene activation of human protein tyrosine phosphatase receptor type S |
CNY 12,255.00 |