GRK5 Human Gene Knockout Kit (CRISPR)

CAT#: KN209137

GRK5 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


GRK5 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


GRK5 (Myc-DDK-tagged)-Human G protein-coupled receptor kinase 5 (GRK5)
    • 10 ug

CNY 4,392.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol GRK5
Locus ID 2869
Kit Components

KN209137G1, GRK5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGAAAACATCGTGGCCAACA

KN209137G2, GRK5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GTCTTGCTGAAAGCCAGGGA

KN209137-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_005308
Synonyms GPRK5
Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...