NADPH oxidase 4 (NOX4) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	NADPH oxidase 4
Locus ID	50507
Kit Components	KN208007G1, NADPH oxidase 4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAGCTGGCTCGCCAACGAAG KN208007G2, NADPH oxidase 4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCTAGCCCGCCATCCTACC KN208007-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_001143836, NM_001143837, NM_001291926, NM_001291927, NM_001291929, NM_001300995, NM_016931, NR_026571, NR_120406
Synonyms	KOX; KOX-1; RENOX
Summary	This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.