TOE1 Human Gene Knockout Kit (CRISPR)
CAT#: KN203377
TOE1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | TOE1 |
Locus ID | 114034 |
Kit Components |
KN203377G1, TOE1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AACTGCGCCATCGTCACTGT KN203377G2, TOE1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GACGGTGAGCGGCTTCCCAG KN203377-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_025077 |
Synonyms | FLJ13949 |
Summary | Inhibits cell growth rate and cell cycle. Induces CDKN1A expression as well as TGF-beta expression. Mediates the inhibitory growth effect of EGR1. Involved in the maturation of snRNAs and snRNA 3'-tail processing (PubMed:28092684).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN203377BN | TOE1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN203377LP | TOE1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN203377RB | TOE1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN403377 | TOE1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA114425 | TOE1 CRISPRa kit - CRISPR gene activation of human target of EGR1, exonuclease |
CNY 12,255.00 |