CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA	Luciferase-Puro
Symbol	CD20
Locus ID	931
Kit Components	KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT KN201242LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_021950, NM_152866, NM_152867
Synonyms	B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary	This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.