CD20 (MS4A1) Human Gene Knockout Kit (CRISPR)
CAT#: KN201242LP
MS4A1 - human gene knockout kit via CRISPR, HDR mediated
HDR-mediated knockout kit validation
CNY 12,260.00
CNY 3,710.00
CNY 1,999.00
CNY 2,700.00
CNY 2,400.00
CNY 4,465.00
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | CD20 |
Locus ID | 931 |
Kit Components |
KN201242G1, CD20 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCCTATTGCTATGCAATC KN201242G2, CD20 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATCCTCCTGAAGAGTGGTTT KN201242LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_021950, NM_152866, NM_152867 |
Synonyms | B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7 |
Summary | This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201242 | MS4A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201242BN | MS4A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201242RB | MS4A1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN401242 | MS4A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |
|
GA100658 | MS4A1 CRISPRa kit - CRISPR gene activation of human membrane spanning 4-domains A1 |
CNY 12,255.00 |