Junctional Adhesion Molecule 1 (F11R) Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA	GFP-puro
Symbol	Junctional Adhesion Molecule 1
Locus ID	50848
Kit Components	KN200004G1, Junctional Adhesion Molecule 1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACCGATTCCTCCCGAAACTC KN200004G2, Junctional Adhesion Molecule 1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGACAAAGGCGCAAGTCGAG KN200004-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq	NM_016946, NM_144501, NM_144502, NM_144503, NM_144504, NM_001348091
Synonyms	CD321; JAM; JAM1; JAMA; JCAM; KAT; PAM-1
Summary	Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.