Sequencing Primer, tGFP_R

Specifications

Product Data
sds_url	/sds/ge100142.pdf
_pt	1
components	1 vial of lyophilized sequencing primer (1 nmol, sufficient for 100 sequencing reactions)
_c	dna-sequencing-primer
availabilities_filter	In Stock
sub_category	DNA Sequencing Primers
description	Reverse primer to sequence targets cloned in expression vectors.
pdf_url	/datasheet/ge100142.pdf
storage	Store at -20°C.
product_name	Sequencing Primer, tGFP_R
reverse_seq	CTGCTCGGGGGTGCCCTCTCC
category	Gene Expression
stability	The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C
sizes_filter	1 nmol
quality_control	The primer has been tested to generate satisfactory sequencing data on ABI 3730.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.