Mouse Piezo1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Piezo1
Locus ID	234839
Kit Components	GA214575G1, Piezo1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGAAAGTTGCTCCAACCACG GA214575G2, Piezo1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTACTCGCACTGTGCCCGT GA214575G3, Piezo1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACAGTGCGAGTAACTGCGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001037298, NM_001357349
Synonyms	9630020g22; Fam38a; mKIAA0233

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.