Mouse Krt5 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Krt5
Locus ID	110308
Kit Components	GA212304G1, Krt5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCAGGACACCAGCTCTGTA GA212304G2, Krt5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACCACTGTGCAGGTGTGC GA212304G3, Krt5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTGGGCTGGGCATGCCTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_027011
Synonyms	3300001P10Rik; AW146334; CK5; K5; Krt2-5; Tfip8

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.