Mouse Pdx1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Pdx1
Locus ID	18609
Kit Components	GA203166G1, Pdx1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTACCCTGGAGCCATCAT GA203166G2, Pdx1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTCCAGGGTAAACCACGT GA203166G3, Pdx1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTCTGGGGCACCCCACG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008814
Synonyms	IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
Summary	Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.