Mouse H19 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	H19
Locus ID	14955
Kit Components	GA201799G1, H19 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCACCACCGTTCTATGA GA201799G2, H19 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGACATCAAGGGAGATATC GA201799G3, H19 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCGCTGGAACGATACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NR_001592, NR_130973, NR_130974

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.