Mouse Calb2 activation kit by CRISPRa

CAT#: GA200493

Calb2 CRISPRa kit - CRISPR gene activation of mouse calbindin 2



  See Other Versions

CN¥ 12,255.00


货期*
4周

规格
    • 1 kit

Product images

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol Calb2
Locus ID 12308
Kit Components

GA200493G1, Calb2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGTCCTGTGACTCCCTCG

GA200493G2, Calb2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTCCAGCTAAATACCTG

GA200493G3, Calb2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCTGGGTGCCCTCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_007586, NM_001368293, NM_001368294
Synonyms CR
Summary Calretinin is a calcium-binding protein which is abundant in auditory neurons.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...