Mouse Calb2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Calb2
Locus ID	12308
Kit Components	GA200493G1, Calb2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGTCCTGTGACTCCCTCG GA200493G2, Calb2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTCCAGCTAAATACCTG GA200493G3, Calb2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCTGGGTGCCCTCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_007586, NM_001368293, NM_001368294
Synonyms	CR
Summary	Calretinin is a calcium-binding protein which is abundant in auditory neurons.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.